Novel Insights into Preeclampsia: Investigating the Role of Htra4

Preeclampsia (PE), a serious pregnancy complication characterized by high blood pressure and signs of damage to another organ system, often the kidneys or liver, poses significant risks to both mother and child.Recent research has focused on identifying key molecular players involved in the pathogenesis of early-onset PE. This article delves into the methodologies employed to investigate the role of Htra4 in this condition.

Ethical Considerations and Sample Collection

The integrity of research relies on adherence to ethical guidelines and rigorous sample collection protocols. This study was conducted in accordance with the Helsinki Declaration, ensuring the protection of human subjects. The research team secured approval from the Ethics Committee of the Second Hospital of Hebei Medical University in Shijiazhuang, China (Approval No. 2024-R581). Furthermore, informed consent was obtained from all participants.

Key aspects of the study included:

• Collection of baseline data and samples from early-onset PE patients and normal controls.
• Collection of peripheral blood and umbilical cord blood.
• Collection of tissue samples from the decidua and placenta.

Detailed inclusion and exclusion criteria for participants are available in the supplementary details.

Molecular Analysis Techniques

To elucidate the role of Htra4, several molecular analysis techniques were employed. These methods provide insights into protein expression, gene expression, and cellular localization.

Western Blot Assay

Western blot analysis was performed to assess protein expression levels. The procedure involved:

1. Lysing placental tissue (approximately 100 g) or HUVECs using high-efficiency RIPA lysis buffer containing 1% PMSF at 4 °C for 30 minutes to extract total protein.
2. Centrifuging the lysate at 12,000 rpm for 15 minutes to collect the protein supernatant.
3. Measuring protein content using the Pierce BCA protein assay kit.
4. Performing electrophoresis on SDS-PAGE gels and transferring protein samples onto PVDF membranes by electroblotting.
5. Blocking the PVDF membranes with nonfat milk and incubating with primary antibody at 4 °C overnight, followed by incubation with HRP-conjugated secondary antibodies at room temperature for 1 hour.
6. Developing blots using supper ECL.

Primary antibodies used included ERK/p-ERK, JNK/p-JNK, P38/p-P38, NF-κB p65 (Santa Cruz), NRF2, HO-1, NQO-1, Htra4 (Bioss, Beijing, China), GAPDH, and β-actin. HRP-conjugated secondary antibody was sourced from ABclonal, Wuhan, China.

qRT-PCR Assay

Quantitative real-time polymerase chain reaction (qRT-PCR) was used to quantify gene expression. The steps included:

1. Isolating total RNA from placental tissue and HUVECs using RNAiso Plus.
2. Reverse transcribing RNA into cDNA with PrimeScript™ IV 1st strand cDNA Synthesis Mix.
3. Quantifying gene expression using TB Green^® Premix Ex Taq™ II FAST qPCR.

The primer sequences used were:

• Htra4, F: 5’-TGAAGAGTGGAAGCGAGGAAGG-3’, R: 5’- AGAGGACGGGCACCAGGAG-3’
• IL-6, F: 5’- GCGCTTGTGGAGAAGGAGT-3’, R: 5’-TGGAGATGTCTGAGGCTCATT-3’
• IL-1β, F: 5’-TGGAGATGTCTGAGGCTCATT-3’, R: 5’- GACAAGCTGAGGAAGATGCT GG-3’
• GAPDH, F: 5’-CTAAACAGATGAAGTGCTCC-3’, R: 5’-ACGACCAAATCCGTTG ACTC-3’

Immunofluorescence Staining

Immunofluorescence staining was performed to visualize the localization of specific proteins within tissues and cells.

Tissue Immunofluorescence Staining:

1. Paraffin sections were deparaffinized in xylene, followed by hydration in varying concentrations of ethanol.
2. Permeabilization was achieved using a 0.1% Triton x-100 PBS solution at 4 °C for 1 hour.
3. Antigen retrieval was performed using a citrate buffer mixture.
4. Sections were blocked in a 1% Tween-20 PBS solution at 4 °C for 10 minutes, followed by incubation with a 5% BSA PBS solution at room temperature for 1 hour.
5. The primary antibody was diluted in the 5% BSA PBS solution and incubated with the sections at 4 °C overnight.
6. Sections were then incubated with a fluorescein-conjugated secondary antibody,which was diluted in a 5% BSA PBS solution at room temperature for 1 hour.
7. DAPI was utilized to stain the nuclei at room temperature for 5 minutes prior to observation under a fluorescence microscope.

Cellular Immunofluorescence Staining:

1. Following treatment with recombinant Htra4 protein, HUVECs were washed with cold PBS and then fixed with 4% paraformaldehyde at room temperature for 15 minutes.
2. Later, the cells were permeabilized using a 0.1% Triton x-100 PBS solution at room temperature for 15 minutes, followed by blocking with a 5% BSA PBS solution at room temperature for 1 hour.
3. The cells were incubated overnight at 4 °C with the primary antibody, which was diluted in a 5% BSA PBS solution.
4. Next, the cells were incubated with a fluorescein-conjugated secondary antibody, also diluted in the same solution, at room temperature for 1 hour.
5. DAPI was utilized to stain the nuclei at room temperature for 5 minutes prior to observation under a fluorescence microscope.

Hematoxylin and Eosin Staining

Hematoxylin and Eosin (H&E) staining is a standard histological technique used to visualize tissue morphology. The procedure involved:

1. Deparaffinizing paraffin sections in xylene and subsequently hydrating in ethanol of diverse concentrations, followed by washing with tap water for 5 minutes.
2. Performing Hematoxylin staining for 5 minutes, followed by a 5-minute wash with tap water.
3. Treating the sections with hydrochloric acid alcohol for 5 seconds and washing with tap water for 3 minutes.
4. Subsequently, treating sections with 1% ammonia water for 30 seconds and washing with tap water for 5 minutes.
5. After that, incubating the sections with 80% and 90% ethanol for 5 minutes respectively.
6. Performing Eosin staining for 2 minutes.
7. Next, using 95%, 100% I, and 100% II alcohol to treat the paraffin sections for 5 minutes.
8. after a 10-minute treatment with xylene, the sections were mounted with neutral resin.

assessing Oxidative Stress

Oxidative stress, an imbalance between the production of reactive oxygen species (ROS) and the ability of the body to detoxify them, is implicated in the pathogenesis of preeclampsia. The study employed specific assays to measure ROS levels and assess oxidative stress markers.

ROS Detection

Reactive oxygen species (ROS) levels in HUVECs were measured using the Reactive Oxygen species Assay kit. The protocol included:

1. Seeding HUVEC cells with robust growth in a 96-well plate.
2. After treatment with recombinant Htra4 protein for 12 hours,incubating the cells in serum-free DMEM medium containing 10 µM DCFH-DA for 30 minutes.
3. Subsequently, removing the medium and washing the cells three times with cold PBS before being observed and photographed under a fluorescence microscope.

MDA and GSH Detection

Malondialdehyde (MDA) and Reduced Glutathione (GSH) levels were measured to assess oxidative stress. MDA is a marker of lipid peroxidation, while GSH is a major antioxidant.

MDA Measurement:

The Malondialdehyde (MDA) Content Assay Kit was utilized to measure MDA levels in huvecs.The procedure involved:

1. Seeding HUVECs cells in a 6-well plate.
2. Following treatment with recombinant Htra4 protein for 12 hours, washing the cells with cold PBS and harvesting using 1 ml of extraction solution.
3. Achieving cell lysis using an ultrasonic processor, followed by centrifugation at 8,000 g for 10 minutes to collect the supernatant.
4. Subsequently, adding reagents according to the manufacturer’s instructions and heating at 100 °C for 1 hour.
5. Measuring absorbance at wavelengths of 532 nm and 600 nm using a microplate reader.

GSH Measurement:

The GSH levels in HUVECs were measured using the reduced Glutathione (GSH) Content Assay Kit. The protocol included:

1. Following treatment with recombinant Htra4 protein for 12 hours, washing cells with cold PBS and collecting using 1 ml of extraction solution.
2. Achieving cell lysis using an ultrasonic processor, followed by centrifugation at 12,000 g for 10 minutes to collect the supernatant.
3. Subsequently, adding reagents according to the manufacturer’s instructions and incubating at room temperature for 2 minutes before measuring the absorbance at a wavelength of 412 nm.

Statistical Analysis

Rigorous statistical analysis is crucial for interpreting research findings. SPSS 26 and GraphPad Prism 10 were utilized for data analysis. The data were presented as mean ± SEM. Pairwise comparisons were conducted using the SNK (Student-newman-Keuls) test. The interdependent relationship between two variables was examined through Pearson/spearman linear correlation analysis, with a significance level of α = 0.05 employed for the test. Levels of *p p p